Rare case of fungal keratitis caused by corynespora cassiicola. Eye surgeries may be either intraocular (such as cataract, glaucoma, retina) or extra-ocular such as refractive or muscle surgery. OD, OculusDexter, representing the right eye; OS, OculusSinister, representing the left eye. In the rural areas, the occurrence of post-traumatic endophthalmitis may be as high as 80% after an injury. Intra-vitreal Dexamethasone injection (400 mg/0.1 mL) after vitrectomy may lead to a rapid subsidence of the intraocular inflammation. The Phylogenetic trees based on ITS, tef-1, and RPB2 also indicated that the isolated strain of this case belonged to the species C. cassiicola (Figure4; Supplementary Figure3). In recent years, increasing number of iatrogenic cases of endophthalmitis have been reported as a result of increased used of intra-vitreal injections for various retinal conditions. The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. Many cases of infectious keratitis may progress to endophthalmitis if not treated early in the course of the diseases. In most cases, regardless of the cause, endophthalmitis can be treated in the office with injection of antibiotics into the eye. Endophthalmitis The PCR method offers much improved pathogen detection especially in the case of chronic endophthalmitis with low pathogen counts. Methods: Samples from the patients intraoperative pus were collected for microscopic examination and culture. [88, 89] In some cases, the culture of the vitreous samples may not grow any bacteria probably due to effect of antibiotics. [28, 31] Poor prognosis stems from the presence of more virulent pathogens, presence of mixed infections, traumatic tissue injury and the failure to start prophylactic antibiotics. One may see evidence of a small hypopyon along with signs of iritis that may result in iris atrophy. General anesthesia may be indicated in cases of severely inflamed eyes. [61] The filamentous fungus especially Aspergillus as well as Fusarium cause infection following trauma with soil contaminated objects. Natural substrate potato dextrose agar (PDA) agar medium was prepared using 20g of dry powder of PDA medium (Beijing Tiantan Bio) dissolved in 1,000 ml of supernatant of distilled water soaked in dry leaves (Zhang, 2018). Keywords: ocular infection, Corynespora cassiicola, morphology, pseudospores, drug sensitivities, Citation: Wang Q, Wang L, Lian L, Pu X, Tang L, Li Y and Liu Y (2023) Case report: A case of ocular infection caused by Corynespora cassiicola. Clear mycelium with septa and branches were observed (Supplementary Figure1). Patients having ocular symptoms and signs in the absence of trauma or ocular surgery and presence of risk factors such as diabetes, cardiac disease, renal disease, organ transplantation, immunodeficiency status and malignancy should be evaluated for endogenous endophthalmitis. Symptoms Management in these patients may require early intervention that includes intra-vitreal antibiotics guided by the organisms seen on Gram and Ziehl-Neelsen stains of anterior chamber and vitreal taps. (2011). [7] In Candida infections, localized fluffy creamy white retinal or sub-retinal nodules may be associated with vitreous haze. (2016). [19] Conjunctival and corneal swabs are usually not helpful, as the correlation with the microorganisms isolated is very low. It can occur after a penetrating wound of the eye (either surgical or accidental), bacterial infection, or intraocular foreign Received: 07 February 2023; Accepted: 06 June 2023;Published: 28 June 2023. Predictive factors for the good visual outcome in these patients included good initial presenting VA, early surgical intervention to remove IOFB (within 24 hours), and PPV. See more. The most common organisms identified were coagulase-negative staphylococci and Streptococcus species. Significant eye pain. It is recommended that minimizing the contact between IOL and the ocular surface may reduce the risk of endophthalmitis at the time of its implantation. Early diagnosis and treatment is vital for preventing vision loss. The positive rate for identification of any causative organism may be 87% for vitreous, 32% for aqueous humor, and 33% for blood. A diagnosis of endophthalmitis was made and patient was treated with intra-vitreal antibiotics after obtaining vitreous biopsy. It can also occur in association with general surgery, systemic infection, or eye injury. What is Endophthalmitis? - American Academy of Ophthalmology Mycol. Three cases of eye infection (case nos. Zhang, X. G. (2018). endophthalmitis doi: 10.1007/s00134-022-06713-1, Sumabat, L. G., Kemerait, R. C., Jr, Kim, D. K., Mehta, Y. R., Brewer, M. T. (2018). Overall, clear corneal phacoemulsification had a 1.73-fold higher risk for acute endophthalmitis than extra-capsular cataract extraction but the visual outcome was worse in post-extra capsular cataract extraction cases. Because of the difficulty in culturing Propionibacterium acnes and the high rate of recurrence, anterior vitrectomy may be necessary. His examination was significant for having an evidence of anterior chamber reaction in the form of hypopyon and vitritis. Endogenous bacterial endophthalmitis usually leads to total loss of vision. [3] These infections are usually associated with trauma, but can follow intraocular surgery especially in the rural settings. As PhD students, we found it difficult to access the research we needed, so we decided to create a new Open Access publisher that levels the playing field for scientists across the world. If any of these investigations yield a positive result, the case can be classified as a proven case of infective endophthalmitis; otherwise the case should be classified as presumed unproven endophthalmitis. Endophthalmitis is a medical emergency and can result in vision loss. [25] One needs to be aware, that Propionibacterium acnes may appear as a Gram-variable coccobacillus when the specimen is obtained from the anterior chamber or vitreous. Licensee IntechOpen. They depend on what caused the eye infection: Postoperative endophthalmitis. J. Clin. Several cases were associated with risk factors for fungal infections, such as malnutrition, long-term corticosteroid inhalation, and diabetes (Huang etal., 2010; Xie etal., 2018; Wang etal., 2019). Infection is usually the cause of endophthalmitis. Intra-vitreal Dexamethasone at the time of vitreal biopsy and intra-vitreal antibiotics has been found to be very helpful in minimizing uveal tissue damage. Clonality and geographic structure of host-specialized populations of corynespora cassiicola causing emerging target spot epidemics in the southeastern united states. This association was also observed in the EVS trial, patients with diabetes had a trend toward worse vision at baseline, higher incidence of positive cultures and need for additional surgeries during follow-up. [50] Worse view of the fundus in the Streptococcus cases likely compelled the treating clinician to more frequently favor PPV. . The bacterial species include Mycobacterium chelonae, Nocardia species, Staphylococcus aureus, streptococci and Coliforms as well as Capnocytophaga. In these cases, one has to perform capsulectomy to remove the nidus of infection and make the area more accessible for the antibiotic penetration. WebEndophthalmitis typically causes severe ocular ache and decreased vision. Exogenous fungal endophthalmitis is mostly sight threatening unless aggressive intervention by antifungal therapy and surgery initiated. It may be given topically, sub-conjunctivaly, and intra-vitreally. In bilateral infection, simultaneous ocular involvement is the rule; however, one eye is characteristically more severely affected than the other eye. [8, 37] Facial cellulitis is rarely reported as a focus of infection leading to endogenous endophthalmitis. Endophthalmitis [ 1] Orbital and peri-orbital cellulitis have been reported as causes of endogenous endophthalmitis. [71] The poor visual outcome in these patients has been related to the delay in the early diagnosis and appropriate timely treatment. decreased, blurred or lost vision. Vitreous biopsy should be considered because a culture of the vitreous sample is useful for identifying the responsible bacteria. https://medical-dictionary.thefreedictionary.com/endophthalmitis. Endophthalmitis [7, 52] In these circumstances and in the absence of any prospective studies, careful evaluation of each case may be recommended by the treating ophthalmologist. [33, 51, 52] According to the EVS recommendations, patients with acute post-operative endophthalmitis after a cataract operation with an initial vision of hand movements or better can be treated by vitreous biopsy and intra-vitreal antibiotics. Microbiol., 28 June 2023, https://doi.org/10.3389/fcimb.2023.1160831, https://www.frontiersin.org/articles/10.3389/fcimb.2023.1160831/full#supplementary-material, Creative Commons Attribution License (CC BY), Clinical Laboratory, The General Hospital of Western Theater Command, Chengdu, China. On occasion, the onset of symptoms may be more gradual over weeks to months. The primer sequences (5-3) were ITS1: TCCGTAGGTGAACCTGCGG and ITS4: TCCTCCGCTTATTGATATGC for ITS (White etal., 1990); T1: AACATGCGTGAGATTGTAAGT and Bt2b: ACCCTCA-GTGTAGTGACCCTTGGC for BT2 (Rezaei-Matehkolaei etal., 2014); EF1-1018F: GAYTTCATCAAGAACATGAT and EF1-1620R: GACGTTGAADCCRACRTTGTC for tef-1 (Raja etal., 2017); DRPB2-5F: GAYACNGAYGAYCGWGAYCAYTTYGG and DRPB2-7R: AANCCCATDGCYTGYTTDCCCAT for RPB2 (Voglmayr etal., 2020). doi: 10.1016/j.jinf.2009.11.002, Looi, H. K., Toh, Y. F., Yew, S. M., Na, S. L., Tan, Y. C., Chong, P. S., et al. reviewed 267 reported cases of endogenous bacterial endophthalmitis and also presented a 17-year prospective series. Effective therapy requires proper identification of the causative organisms and their sensitivity to the desired antifungal agents (Figure 13). Symptoms. [98] Fungal endopthalmitis has a poor visual outcome as compared to bacterial endophthalmitis. Loss of vision. [33] Specific eyelid or peri-orbital diseases such as blepharitis, ectropion, entropion and paralytic disorders may enhance the chance of post-operative endophthalmitis. According to the EVS, systemic antibiotics do not appear to have any effect on the course and outcome of endophthalmitis after cataract surgery. Notably, the penetration ability of antifungal drugs should be considered in case of eye infection, as echinocandins lack of penetration into vitreous. Caspofungin appears to have a very good activity against Candida and Aspergillus species and when administered systemically along with Voriconazole, it has been found to be very effective in treating endophthalmitis caused by these organisms. Rapid detection and identification of the causative pathogens is crucial for vision-saving treatment. Infected eye: Causes, symptoms, pictures, and treatment Retrospective studies have confirmed this notion that affected eyes can benefit from early PPV. All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Most frequent causative organisms isolated in cases of delayed-onset bleb-related endophthalmitis include, Streptococcus species, Enterococcus and Gram-negative bacteria. Streptococcus, Pseudomonas, and Serratia cases were associated with poor presenting view of the fundus and worse visual outcomes than coagulase-negative Staphylococcus and Moraxella cases. Generally, endophthalmitis in these cases may have more aggressive set of bacterial pathogens and therefore require vitrectomy along with intra-vitreal as well as systemic antibiotics. Immediate PPV can remove the highly inflammatory bacterial pathogens from the vitreous cavity. No antifungal drugs were given. Endophthalmitis Endophthalmitis 19 (11), 13291352. [72, 84] On MRI of the orbits, intra-ocular hyperintensity on fluid-attenuated inversion recovery and diffusion-weighted images have been found to be very useful for diagnosing endophthalmitis. The spectrum of the microorganisms causing endophthalmitis may differ in different parts of the World. Data from the EVS may not be applicable to cases of endogenous endophthalmitis because the spectrum of causative organisms differs significantly in endogenous endophthalmitis as compared to post-operative endophthalmitis. Symptoms of endophthalmitis include: eye pain; redness; changes in vision; sensitivity to light; Diagnosis and treatment 60 (2), 188190. Aggressive therapy and early vitrectomy may be considered in endogenous endophthalmitis caused by virulent pathogens such Pseudomonas aeruginosa and in cases of Klebsiella endophthalmitis. Procedures, such as penetrating keratoplasty, trabeculectomy, and glaucoma drainage device implantation have all been reported to cause endophthalmitis which are higher than simple cataract operation (Figure 5). Symptoms of acute endophthalmitis in these patients may include decreased vision, pain, swollen eye lids, conjunctival chemosis with discharge and photophobia. Although, the principles of management in cases of post-traumatic and endogenous endophthalmitis may be the same as for acute post-operative endophthalmitis, the visual outcome is usually dismal. We are also actively involved in retina clinical trials and operate a fully staffed retina research center so that we can provide our patients with the most advanced retinal care available. Additional symptoms vary. External photograph of a 63-years-old patient who presented with decreased vision, redness, tearing and pain in his right eye after having trauma several days earlier (a). doi: 10.1007/s10875-018-0549-0, PubMed Abstract | CrossRef Full Text | Google Scholar, Chung, S. R., Lee, H. S., You, I. C. (2018). Microorganisms are then able to spread through the heart to the internal carotid artery and ophthalmic artery. Symptoms Although systemic and intra-vitreal antibiotics may be sufficient in milder forms of infection, PPV has been shown to be helpful in severe cases of endogenous endophthalmitis. Mycopathologia 184 (5), 691697. Staphylococcus species and Streptococcus species were the most common micro-organisms encountered. A clinical diagnosis of endophthalmitis was made, a vitreous tap was performed and intra-vitreal antibiotics were administered. Current protocol includes Gram positive coverage by Vancomycin (1.0 mg/0.1 mL) along with Gram-negative coverage by Ceftazidime (2.25 mg/0.1 mL). One is exogenous endophthalmitis, i.e., the infection travels inside the eye through the outside. Systemically administrated Voriconazole has a good intraocular penetration with minimal systemic side effect profile as compared with amphotericin B. What is Endophthalmitis? Without an imaging study, the IOFB can be missed. Unfortunately, because of the patients delay in presentation and lack of antifungal therapy, the left eyeball was completely destroyed by the time of admission, with the serious consequence of ocular blindness. Inflammation of the intraocular structures. Delayed removal of IOFB following trauma may result in a significant increase in the development of clinical endophthalmitis. Clear mycelium with septa and branches were observed in smear test, and grayish-white fluffy colonies were cultured in different types of medium. Endogenous bacterial endophthalmitis is bilateral in approximately 14- 25% of cases. PCR was extensively evaluated in the multi-center European prophylaxis study of postoperative endophthalmitis following cataract surgery and was found to be useful in identifying 6 out of 20 pathogens causing endophthalmitis where standard Gram-stain and cultures results were found to be negative. WebSymptoms Decreased vision Pain Increasing redness or swelling, especially after eye surgery The symptoms described above may not necessarily mean that you have endophthalmitis. [9]. One (case no. (2017). The authors reported a successful outcome in their patients bilateral endogenous endophthalmitis following timely treatment with the intra-vitreal as well as systemic antibiotic administration. A diagnosis of endogenous endophthalmitis was made in the absence of patients having no prior history of ocular trauma or surgery. Depending on the virulent nature of the infecting organism, post-traumatic endophthalmitis may occur within hours or several weeks after trauma. Routine immediate vitrectomy is not necessary in eyes presenting with better than light-perception vision. 2, 7, and 12 in Supplementary Table2) used systemic and/or topical VRC. Copyright 2023 Wang, Wang, Lian, Pu, Tang, Li and Liu. These results meant that the cornea and eyeball of left eye were almost completely destroyed (Figure1). 7 in Supplementary Table2) additionally used amphotericin B injected into the anterior chamber (Chung etal., 2018), and one (case no. [71, 82] These numbers differ significantly from East Asia, where most cases of endogenous endophthalmitis are caused by Gram-negative organisms especially Klebsiella species accounting for 80% to 90% of positive cultures. Immunol. These anatomical characteristics explain how facial cellulitis can be a primary infection site of endogenous endophthalmitis. [67], The most frequent risk factors for developing endogenous endophthalmitis include a prior history of diabetes mellitus, gastrointestinal disorders, hypertension, heart valve diseases, endocarditis, chronic obstructive lung disease, previous wound infection, meningitis, urinary tract infection, cystic fibrosis, immune-compromised status, splenectomy, organ transplantation and indwelling intravenous catheters, hepatic abscess, hemodialysis fistula, peritonitis and intravenous drug abuse (Figure 15). Pus samples were taken from intraoperative milky white purulent flocculent. During the era of extra capsular cataract extraction under improved hygiene conditions, the infection rate has fallen below 0.1% in the developed countries. [2, 3] Gram-negative species may account for up to 6% of endophthalmitis cases. In contrast, post-traumatic endophthalmitis occurred in 11% of 204 patients in non-rural districts. This condition is usually very difficult to diagnose, since the signs and symptoms resemble a lot of other pathological conditions. Computed tomography (coronal view) of his brain revealed evidence of septic emboli (c). For Candida retinochoroiditis without endophthalmitis, treatment is effective with systemic Ketoconazole, Fluconazole, or Voriconazole. Less frequent causes are other Candida species, Torulopsis glabrata, Cryptococcus neoformans, Sporothrix schenckii, Scedosporium apiospermum (Pseudallescheria boydii), Blastomyces dermatitidis, Coccidioides immitis, and Mucor. It is a serious intraocular inflammatory disorder affecting the vitreous cavity that can result from exogenous or endogenous spread of infecting organisms into the eye. Voriconazole (VRC) and amphotericin B (AMB) were the most frequently used agents against this organism, which resulted in successful treatment outcomes in most cases (Supplementary Table2). A large amount of milky white purulent flocs was seen during the operation, and the pus in the anterior chamber was taken for microbial smear and culture. These patients may also require systemic antibiotics. Endophthalmitis [1-3] In severe cases, 3-port PPV is recommended depending on the level of visualization. PCR reaction system: Taq of 0.5 l, 2 Taq Master Mix of 25 l, deoxynucleotide triphosphates (dNTPs) of 5 l, upstream and downstream primers of 0.5 l each, template DNA of 2 l, and ddH2O of up to 50 l. When to see a doctor What causes your symptoms Treatment information etc. Webendophthalmitis. Amphotericin B can be administered intravenously combined with oral Flucytosine for severe Candida endophthalmitis associated with retino-choroiditis. Notably, most cases were from Asia. It can occur after a penetrating wound of the eye (either surgical or accidental), bacterial infection, or intraocular foreign bodies. External photograph of left eye of an elderly female who developed fungal keratitis and endophthalmitis requiring surgical as well as systemic antifungal treatment. [2, 3, 69, 91]. Objective: The aim of this study is to identify the pathogen causing ocular infection in a Chinese patient and to describe its morphological characteristics. 1 [31]. Less common causes of endogenous endophthalmitis include orbital and periorbital cellulitis and in rare cases facial cellulitis. Bleb-related endophthalmitis usually follows a chronic course of infection (Figure 8). Potential alternate of Amikacin and Ceftazidime may include 3rd and 4th generation fluoroquinolones, such as Levofloxacin and Moxifloxacin, with their enhanced activity against Gram-positive pathogens having broad-spectrum activity that covers most organisms encountered in bacterial endophthalmitis. This large study revealed that culture-positive cases were associated with worse presenting visual acuity, higher presenting intraocular pressure, and worse visual outcomes than culture-negative cases. [81, 99] Endophthalmitis may occur in patients with candidemia depending on the population studied, especially those with an organ transplant and having a highly immunocompromised status. 38 (7), 794803. Compared with published series of post-operative or post-traumatic endophthalmitis, patients with endogenous endophthalmitis are more likely to have fungal isolates with a predominance of Candida albicans. The studies involving human participants were reviewed and approved by The ethics committee of General Hospital of Western Theater Command. The pus specimens were inoculated aseptically with blood medium, chocolate medium, and Sabourauds medium. Phylogenetic trees constructed by maximum likelihood method displayed a consistent result (data not shown). Generally, a combination of intra-vitreal antibiotics is injected that may include Vancomycin, Cephazolin or Ceftazidime and Amikacin after the tap has been performed. [46] The ESCRS demonstrated that the prophylactic use of intra-cameral antibiotics may help to reduce the incidence of post-operative endophthalmitis after cataract surgery by 75%. Prophylactic intra-cameral irrigation of antibiotics such as Cefuroxime and Vancomycin has been found to be beneficial against post-operative endophthalmitis. [3] These patients require immediate vitrectomy along with intra-vitreal antibiotic injection. In these circumstances, representative samples should be collected for endotoxin assay from the various potential sources of TASS. However, no conidia were found in the culture up to 40 days. Endophthalmitis - All About Vision In chronic saccular endophthalmitis, there is granulomatous inflammation and characteristic white capsular plaque. Signs of early post-operative endophthalmitis in patients after intraocular surgery (a) and after repair of traumatic eye injury (b) after injury. She was found to have necrosis of her left corneal wound and extrusion of the implanted intra-ocular lens (b). Its based on principles of collaboration, unobstructed discovery, and, most importantly, scientific progression. white or yellow pus or discharge from the eyes. The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Watery eyes (epiphora). According to the EVS, 38% of eyes with post-operative endophthalmitis demonstrated Gram-positive cocci. External (a) and slit-lamp (b,c) photographs of a patients eye who developed endopthalmitis after intra-viteal Triamcinolone injection to treat post-operative macular edema. Cryptococcus and Fusarium species have also been reported to the cause of endogenous fungal endophthalmitis. History of chronic intravenous drug abuse, dental work, otitis media, soft-tissue infection including orbital cellulitis, and septic arthritis may lead to septicemia and endogenous endophthalmitis. [102] Other predisposing factors include chronic invasive procedures, such as hemodialysis, bladder catheterization, total parenteral nutrition, chemotherapy, dental procedures, and intravenous drug abuse (Figure 18). Type of infecting organism may have prognostic effect on the final visual outcome. This is particularly true in children because of the variety of pediatric cases and lack of sufficient experience in diagnosing in this age group. WebEndophthalmitis definition, inflammation of the ocular cavities, caused by infection, trauma, or allergic reaction. Mycol. Several studies revealed that isolates from the different hosts were genetically distinct and host specialized (Dixon etal., 2009; Sumabat etal., 2018). In endophthalmitis, there is inflammation of the vitreous cavity along with the retinal and uveal components of the eye. Farming may increase the risk of ocular exposure to Corynespora by rubbing eyes after contact with vegetation. Symptoms vary slightly. The examinations of corneal topography showed an abnormal corneal curvature of left eye (Figure1A). [1-3, 12] Majority of patients with post-operative endophthalmitis present with an acute onset usually within a week after surgery. Books > Identification of the causative pathogen by blood, urine, or cerebrospinal fluid culture may be successful in over 75% of endogenous endophthalmitis cases. Mycol Prog. [100] The visual outcome in cases of treated Streptococcal endophthalmitis is generally poor than some of the Staphylococcal species. Microbiol. Endophthalmitis | definition of endophthalmitis by - Medical Prod. When the fundus view is not possible, imaging studies in the form of ultrasonography and computed tomography should be requested. External photograph of a diabetic patient who presented with loss of vision and painful ophthalmoplegia of his right eye along with fever and mental status changes (a). It can occur after a penetrating wound of the eye (either surgical or accidental), bacterial infection, or intraocular foreign bodies. Inflammation of the intraocular structures. The incidence of endophthalmitis associated with IOFB may be even higher in the setting of having a ruptured globe in the rural areas as compared with trauma in the urban setting (Figure 10).